View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1687_low_21 (Length: 434)
Name: NF1687_low_21
Description: NF1687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1687_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 1e-41; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 157 - 251
Target Start/End: Complemental strand, 8908958 - 8908864
Alignment:
| Q |
157 |
tataatgcaacgtttttgtttgatggatgaattttaggcttgcatattctcatgctattttagtaaataaaatattttatcctccaactttggtg |
251 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8908958 |
tataatgcaacgtttttgtttgattgatgaattttaggcttgcatattctcatgctattttagtatataaaatattttatcctccaactttggtg |
8908864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 300 - 397
Target Start/End: Complemental strand, 8908860 - 8908763
Alignment:
| Q |
300 |
tggacaaaagcaagcgaaccagtgattgaatcgagttgtttctatgaggtgtattgcttaagcatcatgagatagaaaggcaaagagtggtgcttgga |
397 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8908860 |
tggacaaaattaagcgaaccagtgattgaatcgagttgtttctttgaggtgtattgcttaagcatcatgagatagaaaggcaaagagtggtgtttgga |
8908763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 16 - 76
Target Start/End: Complemental strand, 8909054 - 8908994
Alignment:
| Q |
16 |
ctcaactccaaacttgcttctaatcgttggtttattttctattgctacttatatcagtggg |
76 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8909054 |
ctcaactccaaccttgcttctaatcgttggtttattttctattgctactgatatcagtggg |
8908994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 303 - 419
Target Start/End: Original strand, 9195662 - 9195777
Alignment:
| Q |
303 |
acaaaagcaagcgaaccagtgattgaatcgagttgtttctatgaggtgtattgcttaagcatcatgagatagaaaggcaaagagtggtgcttggagttca |
402 |
Q |
| |
|
||||||| ||| ||||||||||| |||| |||| | ||| ||||||||||||||| | ||| ||||||| |||| ||||||||| | ||||||||||| |
|
|
| T |
9195662 |
acaaaagtaagtgaaccagtgatcgaatagagtaatctcttggaggtgtattgcttaggaatcgtgagatataaagacaaagagtgattcttggagttca |
9195761 |
T |
 |
| Q |
403 |
ttggaagaaaaaattat |
419 |
Q |
| |
|
|||||| |||||||| |
|
|
| T |
9195762 |
-cggaagagaaaattat |
9195777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University