View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1687_low_40 (Length: 341)
Name: NF1687_low_40
Description: NF1687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1687_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 24 - 300
Target Start/End: Complemental strand, 250525 - 250249
Alignment:
| Q |
24 |
ttcatcatttgttcttttgttcttcctataacaaattaaacaacccaccacaaacttatttatcacacactcatcatcnnnnnnn-cttccatgcttgct |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
250525 |
ttcatcatttgttcttttgttcttcctataacaaattaaacaacccaccacaaacttatttatcacacactcatcatcttttttttcttccatgcttgct |
250426 |
T |
 |
| Q |
123 |
ccaactttctttctccaattttctcatcaacacttgtcttgtctttgaaaatttattttatggatttcaatatcttttttatgacctaattattaatatc |
222 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
250425 |
ccaactttctttctcca-ttttctcatcaacacttgtcttgtctttgaaaatttattttatggattttaatatcttttttatgacctaattattaatatc |
250327 |
T |
 |
| Q |
223 |
tttggtttcttccctatgagtccgatggttttttctttcatgagatgacttctgaaagaaaagtgaatttataaattg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
250326 |
tttggtttcttccctatgagtccgatggttttttctttcatgagatgacttctgaaagaaaagtgaatttataaattg |
250249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University