View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1687_low_45 (Length: 296)
Name: NF1687_low_45
Description: NF1687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1687_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 9 - 287
Target Start/End: Original strand, 47201076 - 47201354
Alignment:
| Q |
9 |
gaagaatattgtggaagagcgattttggcgaatccaaacgatggtaacgttttatcactttacgcagatttgatatgggagtgtcataaggatgctcctc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47201076 |
gaagaatattgtggaagagcgattttggcgaatccaaacgatggtaacgttttatcactttacgcagatttgatatgggagtgtcataaggatgctcctc |
47201175 |
T |
 |
| Q |
109 |
gtgctgagacatattttgatcaagcagttaaagcagctcctgatgactggtaataattcatttcaagcaaagtttcatatgctaaaattcttgttatatc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47201176 |
gtgctgagacatattttgatcaagcagttaaagcagctcctgatgactggtaataattcatttcaagcaaagtttcatatgctaaaattcttgttatatc |
47201275 |
T |
 |
| Q |
209 |
cgtgaaaaataatgaattaatgaaatgattcttttggtgttgttacagttatgttctagcatcatatgcacattttctt |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47201276 |
cgtgaaaaataatgaattaatgaaatgattcttttggtgttgttacagttatgttctagcatcatatgcacattttctt |
47201354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University