View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1687_low_48 (Length: 292)
Name: NF1687_low_48
Description: NF1687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1687_low_48 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 20 - 281
Target Start/End: Complemental strand, 38038508 - 38038224
Alignment:
| Q |
20 |
cataagaaaaca---taatactactaccagggaaaggggacacagcaagaaactgattttccctaagcaaaacctaaacaaaca---------------- |
100 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38038508 |
cataagaaaacatactactactactaccagggaaaggggacacagcaagaaagtgattttccctaagcaaaacctaaacaaacaaacaagtcagaagaag |
38038409 |
T |
|
| Q |
101 |
----aacaagattattacatttaagcagcgttctaaatgcgagtgtcccaaagtgattcttgctgaactttaccactcttcaagagttccgcgatttcct |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38038408 |
ctacaacaagattattacatttaagcagcgttctaaatgcgagtgtcccaaagtgattcttgctgaactttaccactcttcaagagttccgcgatttcct |
38038309 |
T |
|
| Q |
197 |
ctggagggttcaaaccaagcttcacagcacgctccaagcgtgccagcctcgtcatccccatacaaggcccatacttcatgttcat |
281 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38038308 |
ccggagggttcaaaccaagcttcacagcacgctccaagcgtgccagcctcgtcatccccatacaaggcccatacttcatgttcat |
38038224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University