View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1687_low_60 (Length: 252)
Name: NF1687_low_60
Description: NF1687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1687_low_60 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 44 - 197
Target Start/End: Original strand, 38038530 - 38038683
Alignment:
| Q |
44 |
tgttctgttctgttcttatgctgttaattgtgcaattgatacatgttgtttgaggaagtaaattcgaagtcggatacttgtatttcatgattattgacaa |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38038530 |
tgttctgttctgttcttatgctgttaattgtgcaattgatacatgctgtttgagggagtaaattcgaagtcggatacttgtatttcatgattattgacaa |
38038629 |
T |
 |
| Q |
144 |
gaaatgaaattgaaaaagaggaatataaatggccctccaatgcatatgaactta |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38038630 |
gaaatgaaattgaaaaagaggaatataaatggccctccaatgcatatgaactta |
38038683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University