View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1687_low_65 (Length: 246)
Name: NF1687_low_65
Description: NF1687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1687_low_65 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 38 - 231
Target Start/End: Complemental strand, 22742273 - 22742080
Alignment:
| Q |
38 |
ataagagcttaattaagttcttcatctaaacatggcttagatgactatttgtttaccttttggataattttaattttaataagccaattggtggtacatt |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
22742273 |
ataagagcttaattaagttcttcatctaaacatggctttgatgactatttgtttaccatttggataattttatttttaataagccaataggtggtacatt |
22742174 |
T |
 |
| Q |
138 |
ctctagatttcgtttgaatatagtagtttaacttttcagcaagatttgctagtacttattggaaaaatagtaaagcttattgaaacatgaaaac |
231 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22742173 |
ctctaggtttcgtttgaatatagtagtttaacttttcagcaagatttgctagtacttattggaaaaagagtaaagcttattgaaacatgaaaac |
22742080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University