View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1687_low_67 (Length: 245)
Name: NF1687_low_67
Description: NF1687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1687_low_67 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 212
Target Start/End: Complemental strand, 32856552 - 32856358
Alignment:
| Q |
18 |
tcaacaacaccaccatcacagattcacaatctcactttcactgtcatagaacagagtcctccgccacaaccgtagcggcatcaggtatatcttccactgc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32856552 |
tcaacaacaccaccatcacagattcacaatctcactctcaccgtcatagaacagagtcctccgccacaaccgtagcggcatcaggtatatcttccactgc |
32856453 |
T |
|
| Q |
118 |
catctctttcagtgaattgctggttagttagggtttctgctttgagtgtgaactctaacagatctctgtgcatctaagttcttcatgttggtttt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32856452 |
catctctttcagtgaattgctggttagttagggtttctgctttgagtgtgaactctaacagatctctgtgcatctaagttcttcatgttggtttt |
32856358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 116 - 173
Target Start/End: Complemental strand, 32853391 - 32853334
Alignment:
| Q |
116 |
gccatctctttcagtgaattgctggttagttagggtttctgctttgagtgtgaactct |
173 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
32853391 |
gccatctatttcagtgaattgttggttagttagggtttctgatttgagcgtgaactct |
32853334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University