View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1687_low_69 (Length: 242)
Name: NF1687_low_69
Description: NF1687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1687_low_69 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 49019469 - 49019671
Alignment:
| Q |
1 |
gagaatagagacaaagaacaattgaaggttgcactnnnnnnnncacttaacaaaaataaatgttgcatatcataatcctactcacttcattatgcctaca |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49019469 |
gagaatagaaacaaagaacaattgaaggttgcac-caaaaaaacacttaacaaaaataaatgttgcatatcataatcctactcacttcattatgcctaca |
49019567 |
T |
|
| Q |
101 |
atcatgattcttggttccatcacccgcatgctcttttctaaacactctcacacttcttcttcttaatactctcattcttattcatacacacctataaatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49019568 |
atcatgattcttggttccatcacccgcatgctcttttctaaacactctcaca---cttcttcttaatactctcattcttattcatacacacctataaatc |
49019664 |
T |
|
| Q |
201 |
tcattca |
207 |
Q |
| |
|
||||||| |
|
|
| T |
49019665 |
tcattca |
49019671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 61 - 139
Target Start/End: Complemental strand, 7082253 - 7082175
Alignment:
| Q |
61 |
tgttgcatatcataatcctactcacttcattatgcctacaatcatgattcttggttccatcacccgcatgctcttttct |
139 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||| | ||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
7082253 |
tgttgcatatcataatcccattcacttcattatgcccaaaatcatgattcttggtttcatcacccgcatgctctcttct |
7082175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University