View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1687_low_71 (Length: 239)
Name: NF1687_low_71
Description: NF1687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1687_low_71 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 28 - 239
Target Start/End: Complemental strand, 16069975 - 16069769
Alignment:
| Q |
28 |
atatagtttatcatattcaaattgtttaataacgatttccaacttgtcgtattgttttcacctaatcaaataaaatttgtcttgttttatgttcaggata |
127 |
Q |
| |
|
|||||||||||| || ||||||| |||| |||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
16069975 |
atatagtttatcggatacaaattgattaacaacgatttccaacttgtcttattgttttcacctaatcaaataatatttgtcttgttttacgttcaggata |
16069876 |
T |
 |
| Q |
128 |
agtaatatagttcttgagcttggaaaatcagcacataaccgtaattttgtatccctaagattagattagaagaagttttatagaaaacagcaacttgtga |
227 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16069875 |
agtaata--gttcttgagcttggaaaatcagcacataaccttaattttgtatccctaagataagattagaagaagttttatagaaaa---caacttgtga |
16069781 |
T |
 |
| Q |
228 |
ttttattcattt |
239 |
Q |
| |
|
||||||| |||| |
|
|
| T |
16069780 |
ttttattgattt |
16069769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 16061285 - 16061202
Alignment:
| Q |
1 |
cataggacaaaaaagactggtggttgcatatagtttatcatattcaaattgtttaataacgatttccaacttgtcgtattgttt |
84 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||| || ||||||| ||||||||| ||||||||||||| |||||||| |
|
|
| T |
16061285 |
cataagacacaaaagactggtggttgcatatagtttatcagatacaaattgattaataacggtttccaacttgtcttattgttt |
16061202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University