View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1687_low_79 (Length: 218)
Name: NF1687_low_79
Description: NF1687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1687_low_79 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 202
Target Start/End: Original strand, 39315498 - 39315680
Alignment:
| Q |
18 |
agaaatcgattatgaggtgaataatcgaatagttacctgnnnnnnnggagaatttcacgggaaaatgagaattgaaagtaccgtcaccgggaaagggaag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39315498 |
agaaatcgattatgaggtgaataatcgaatagttacctgaaaaa--ggagaatttcacgggaaaatgagaattgaaagtaccgtcaccgggaaagggaag |
39315595 |
T |
|
| Q |
118 |
tgaattggatttgagggagtgaaacggcaacgaacggatgcgctttgcaccttcttttggttatggaccaaatctcttacttcat |
202 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39315596 |
tgaattggatttgagggagtggaacggcaacgaacggatgcgctttgcaccttcttttggttatggaccaaatctcttacttcat |
39315680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University