View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1687_low_82 (Length: 211)
Name: NF1687_low_82
Description: NF1687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1687_low_82 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 53 - 165
Target Start/End: Original strand, 36277788 - 36277900
Alignment:
| Q |
53 |
ctatgctcacggggacgtaatttgtaattttttaaagttgtctattatagacatttgttccgttaaaatatgagttattgaaagnnnnnnnnnctaaatt |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36277788 |
ctatgctcacggggacgtaatttgtaattttttaaagttgtctattatagacatttgttccgttaaaatatgagttattgaaagcaaaaaaaactaaatt |
36277887 |
T |
 |
| Q |
153 |
aattgaagtgtaa |
165 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36277888 |
aattgaagtgtaa |
36277900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University