View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16880_low_5 (Length: 399)
Name: NF16880_low_5
Description: NF16880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16880_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 6e-84; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 6e-84
Query Start/End: Original strand, 227 - 388
Target Start/End: Original strand, 48288986 - 48289147
Alignment:
| Q |
227 |
acttaaactatatcatattcatatgtagatgttaccttggattggggctgtttttcaccatcttctttccgtacttcctccatctgaacccgtcatccag |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48288986 |
acttaaactatatcatattcatatgtagatgttaccttggattggggctgtttttcaccatcttctttccgtacttcctccatctgaacccatcatccag |
48289085 |
T |
|
| Q |
327 |
aatttcaacctctgacttggttttgaatgcaactttatgatctctaatttccttcttctcac |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48289086 |
aatttcaacctctgacttggttttgaatgcaactttatgatctctaatttccttcttctcac |
48289147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 20 - 160
Target Start/End: Original strand, 48288818 - 48288958
Alignment:
| Q |
20 |
tatgtgtgccttcgtaggttgttattacataacttggatcgtccacatctctctcaactctctttttcacttggcatccatccgctgaacacctatagta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48288818 |
tatgtgtgccttcgtaggttgttattacataacttggatcgtccacatctctctcaactctctttttcacttggcatccatccgctgaacacctatagta |
48288917 |
T |
|
| Q |
120 |
gttcctgtaatcaaattggaaattctctcaattaacataaa |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48288918 |
gttcctgtaatcaaattggaaattctctcaattaacataaa |
48288958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 259 - 360
Target Start/End: Original strand, 3734425 - 3734526
Alignment:
| Q |
259 |
taccttggattggggctgtttttcaccatcttctttccgtacttcctccatctgaacccgtcatccagaatttcaacctctgacttggttttgaatgcaa |
358 |
Q |
| |
|
||||||||||| ||||| || || ||||| |||||||| ||||||||||||||| |||| ||||| || ||||||| | |||||| ||||||||||||| |
|
|
| T |
3734425 |
taccttggattagggctattcttaaccattttctttccatacttcctccatctgtacccatcatcaagtatttcaatcagtgactttgttttgaatgcaa |
3734524 |
T |
|
| Q |
359 |
ct |
360 |
Q |
| |
|
|| |
|
|
| T |
3734525 |
ct |
3734526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University