View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16885_high_6 (Length: 314)
Name: NF16885_high_6
Description: NF16885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16885_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 24 - 253
Target Start/End: Complemental strand, 42854080 - 42853848
Alignment:
| Q |
24 |
catcaggtatttgcttagggaaccagagcttttgatcatcgtatccaaagagaaacttgctttcaagaatagagaagatttcatagctgagcttatccgt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42854080 |
catcaggtatttgcttagggaaccagagcttttgatcatcgtatccaaagagaaacttgctttcaagaatagagaagatttcatagctgagcttatccgt |
42853981 |
T |
 |
| Q |
124 |
ttcaatgcttggttcttgcatttcaaattgatcactagaatccattattgttttctgcttttgttgaaacgtgattattgttgcat---gaaggttgttt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42853980 |
ttcaatgcttggttcttgcatttcaaattgatcactagaatccattattgttttctgcttttgttgaaacgtgattattgttgcatgaagaaggttgttt |
42853881 |
T |
 |
| Q |
221 |
gtagagaattttcacctcggaagtgacgcctat |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42853880 |
gtagagaattttcacctcggaagtgacgcctat |
42853848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University