View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16885_high_7 (Length: 303)
Name: NF16885_high_7
Description: NF16885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16885_high_7 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 9 - 303
Target Start/End: Complemental strand, 30527045 - 30526751
Alignment:
| Q |
9 |
agcagagacgggagagggatccatacaaggagaagaagaaatctggatcagatgaagaatatatgattaaagagaaaaagaaatgatacatgatcaaata |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||||| ||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30527045 |
agcaaagacgggagagggatccatacaaggagaagaataaatctgcatcagatgaagtatatatgactaaagagaaaaagaaatgatacatgatcaaata |
30526946 |
T |
 |
| Q |
109 |
gttattatttaatcaatatatttggttctattgtatactctatttatcaaattggggaatgaaaagtaatacgagaggatgatatgaatgcaatgaattc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||| |||||||||| |
|
|
| T |
30526945 |
gttattatttaatcaatatatttggttctattgtatactctatttatcaatttggggaatgaaaaataatatgagaggatgatatgaacgcaatgaattt |
30526846 |
T |
 |
| Q |
209 |
cattatattctatttcacttcattaatttatagaattccaaacaaatgaatataactctatacaacttgattccgcttaatttcatcgattcaaa |
303 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30526845 |
cattatatttcatttcacttcattaatttatagaattccaaacaaatgaatataactctatacaacttgatttcgcttaatttcatcgattcaaa |
30526751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University