View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16886_high_3 (Length: 272)
Name: NF16886_high_3
Description: NF16886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16886_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 7 - 266
Target Start/End: Original strand, 35415681 - 35415940
Alignment:
| Q |
7 |
aacgaacccacctacaaatcagtgagtctgtttaagaaaacagacatactctcatgggttttagagaaaaccacaaacacgggaacaataccaaggcggt |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
35415681 |
aacggacccacctacaaatcagtgagtctgtttaagaaaacagacatactctcatgggttttagagaaaaccacaaacacgggaacaataccaaggaggt |
35415780 |
T |
 |
| Q |
107 |
gttgctggtgatgaacgacccagacgaccaccacaaaacccagatcaagcttcattgtggtctctgattggcgaacaacaagcagactacgaacgagaga |
206 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35415781 |
gttgctggtgatgaacgatccagaagaccaccacaaaacccagatcaagcttcattgtggtctctgattggcgaacaacaagcagactacgaacgagaga |
35415880 |
T |
 |
| Q |
207 |
aactggaatcgtatatacaggaaaccatagcagccaccaaatcgcggggacggtggcacc |
266 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
35415881 |
aactggaatcgtatttacaggaaaccatagtagccaccaaatcgtggggacggtggcacc |
35415940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University