View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16889_high_2 (Length: 294)
Name: NF16889_high_2
Description: NF16889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16889_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 284
Target Start/End: Complemental strand, 15526838 - 15526555
Alignment:
| Q |
1 |
attgataattgttcggtgaagggtgcaaatatcttgtgcatgttaagccagacactagttagcttaacgattcgtaatcattcattccataattacaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| ||| |
|
|
| T |
15526838 |
attgataattgttcggtgaagggtgcaaatatcttgtgcatgttaagccagacactagttagcttaacgatacgtaatcattcattccacaattaccaaa |
15526739 |
T |
|
| Q |
101 |
tcgagctatctgctccaagcctttgtacatttgcttttacgggtactccttatcagacacttcttggaaccaatctttcttctgtcaaaaaagtaattat |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15526738 |
tcgagctatctgctccaagccttcgtacatttgcttttacgggtactccttatcagacacttcttggaaccaatctttcttctgtcaaaaaagtaattat |
15526639 |
T |
|
| Q |
201 |
tgacgcggaaatgatggcaaattacttgatgcctcctttggttttactctcctggctgtctagtcttgctaatatagaatcatt |
284 |
Q |
| |
|
||||||||||||| |||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15526638 |
tgacgcggaaatgttggcaaattactcggtacctcctttggttttactctcctggctgtctagtcttgctaatatagaatcatt |
15526555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 96 - 132
Target Start/End: Complemental strand, 42602346 - 42602310
Alignment:
| Q |
96 |
caaaatcgagctatctgctccaagcctttgtacattt |
132 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
42602346 |
caaaatcgagttatctgctccaagcctttgtgcattt |
42602310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University