View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1688_high_10 (Length: 235)
Name: NF1688_high_10
Description: NF1688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1688_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 10 - 219
Target Start/End: Complemental strand, 402171 - 401962
Alignment:
| Q |
10 |
ctctatcccccaccctgatttttcttggtgaatttctaaactgtaatgcattttcgtagcctgttcgccggatctttgacatttgagccagagagtcatg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
402171 |
ctctatcccccaccctgatttttcttggtgaatttctaaactgtaatgcattttcgtagcctgttcgccggatctttgacatttgagccagagaatcatg |
402072 |
T |
 |
| Q |
110 |
atgttgacatggaaacagaagatgctattaagaatttggatgtggactggttggttaaagtacattatcgtcttgaattgcagacagaggcactctttct |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
402071 |
atgttgacatggaaacagaagatgctattaataatttgaatgtggactggttggttaaagtacattatcgtcttgaattgcagacagaggcactctttct |
401972 |
T |
 |
| Q |
210 |
tactattaac |
219 |
Q |
| |
|
|||||||||| |
|
|
| T |
401971 |
tactattaac |
401962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University