View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1688_low_15 (Length: 213)
Name: NF1688_low_15
Description: NF1688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1688_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 14 - 196
Target Start/End: Complemental strand, 39919972 - 39919790
Alignment:
| Q |
14 |
ttatactattcctgatactaaataattaaacgtcatgttttgctttttatagctggagaaaagaatgcagcttttagaatctattcaatatttaattttg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39919972 |
ttatactattcctgatactaaataattaaacgtcatgttttgctttttatagctggagaaaagaatgcagcttttagaatctattcaatatttaattttg |
39919873 |
T |
|
| Q |
114 |
attgtttcttgaattcatttctccttatgaacctttataaattgaaattaacatggaaagtgacaagtaattttaagactcta |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39919872 |
attgtttcttgaattcatttctccttatgaacctttataaattgaaattaacatggaaagtgacaagtaattttaagactcta |
39919790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University