View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1689-Insertion-14 (Length: 272)
Name: NF1689-Insertion-14
Description: NF1689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1689-Insertion-14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 62; Significance: 7e-27; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 133 - 194
Target Start/End: Original strand, 27219543 - 27219604
Alignment:
| Q |
133 |
tgaaaatcactttttattaaaaatagtaatggaccataattgaatattttatgtggaactat |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27219543 |
tgaaaatcactttttattaaaaatagtaatggaccataattgaatattttatgtggaactat |
27219604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 27579865 - 27579825
Alignment:
| Q |
8 |
aacttctcaatagtctttgcacaaaatgatccccgagaaat |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27579865 |
aacttctcaatagtctttgcacaaaatgatccccgagaaat |
27579825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 8 - 57
Target Start/End: Original strand, 27219391 - 27219440
Alignment:
| Q |
8 |
aacttctcaatagtctttgcacaaaatgatccccgagaaatcacatttag |
57 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||| | |||||| |
|
|
| T |
27219391 |
aacttctcaatagtcttcgcacaaaatgatccccaagaaataatatttag |
27219440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University