View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1689-Insertion-15 (Length: 167)
Name: NF1689-Insertion-15
Description: NF1689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1689-Insertion-15 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 129; Significance: 5e-67; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 129; E-Value: 5e-67
Query Start/End: Original strand, 7 - 167
Target Start/End: Original strand, 33624339 - 33624500
Alignment:
| Q |
7 |
acaaagtatgtatgataatcttgtatacgctatgtaa-aaccnnnnnnntaatcttgtacgttagattattgagatcgaccgtgttattggtgatgttaa |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33624339 |
acaaagtatgtatgataatcttgtatacgctatgtaataaccaaaaaaataatcttgtacgttagattattgagatcgaccgtgttattggtgatgttaa |
33624438 |
T |
|
| Q |
106 |
tcaagtagctgatattcttttaaatattggcttagtttagatttccaaataaatgtttttca |
167 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33624439 |
tcaagtagctgatactcttttaaatattggcttagtttagatttccaaataaatgtttttca |
33624500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University