View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16890_high_1_N (Length: 527)
Name: NF16890_high_1_N
Description: NF16890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16890_high_1_N |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 5e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 7 - 134
Target Start/End: Complemental strand, 56474140 - 56474013
Alignment:
| Q |
7 |
aaaatcaatagaaaaaactcaaacaaacacccaatttcaaattaaggggctagagagttgaaaaccaacatcaacaatcaaactcattctcttctaacca |
106 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||| |||||||||||| ||||| |||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
56474140 |
aaaatcaataaaaaaaactcaaacaaacatccacattcaaattaaggtgctagggagttgaaaaccaacatcaacaatcaaatttattctcttctaacca |
56474041 |
T |
|
| Q |
107 |
aaaccaacatcataaacaagcacataac |
134 |
Q |
| |
|
|||||||||||| |||||||||| |||| |
|
|
| T |
56474040 |
aaaccaacatcacaaacaagcacctaac |
56474013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University