View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16891_high_14 (Length: 305)
Name: NF16891_high_14
Description: NF16891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16891_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 8e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 136 - 295
Target Start/End: Complemental strand, 40193688 - 40193528
Alignment:
| Q |
136 |
cgttccaatttaaagtgtgaacaacgnnnnnnnncagaagaatttgcataaggataatgaggggagcttggaggagtcatggttcatacaagacat-aga |
234 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |
|
|
| T |
40193688 |
cgttccaatttaaagtgtgaacaacgaaaaaaaacagaagaatttgcataaggataatgaggggaggttggaggagtcatggttcatacaagacatcaga |
40193589 |
T |
|
| Q |
235 |
gacaatgatctttactagatgacgtgtgtcatatatgacactgtaacttgttgtctacatt |
295 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
40193588 |
cacaatgatctttactggatgacgtgtgtcatatatgacactataacttgttgtatacatt |
40193528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 19 - 63
Target Start/End: Complemental strand, 40193835 - 40193791
Alignment:
| Q |
19 |
acatcatctagtcagaggtatgtgggagatcgaagatacttccac |
63 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40193835 |
acatcatctagtcagacgtatgtgggagatcgaagatacttccac |
40193791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University