View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16891_high_2 (Length: 409)
Name: NF16891_high_2
Description: NF16891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16891_high_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 150 - 194
Target Start/End: Original strand, 2657528 - 2657572
Alignment:
| Q |
150 |
catcatcaggtttgacattatctcttatcatcacaggttctgctc |
194 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
2657528 |
catcattaggtttgacattatctcttatcatcacagttgctgctc |
2657572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University