View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16891_high_9 (Length: 346)
Name: NF16891_high_9
Description: NF16891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16891_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 1e-69; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 121 - 258
Target Start/End: Complemental strand, 6750701 - 6750564
Alignment:
| Q |
121 |
gacatacaaatgtcaatgtcaaagtatcacaattttacagttcgaatcgttcaaactgtgtcttacatacaatgataccagtctttgcttaatgtcgtag |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6750701 |
gacatacaaatgtcaatgtcaaagtatcacaattttacagttcgaatcgttcaaactgtgtcttacatacaatgatactagtctttgcttaatgtcgtag |
6750602 |
T |
 |
| Q |
221 |
gaatgcctgttaggaaacaaaattaactaagcaggttc |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6750601 |
gaatgcctgttaggaaacaaaattaactaagcaggttc |
6750564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 17 - 75
Target Start/End: Complemental strand, 6750804 - 6750746
Alignment:
| Q |
17 |
ttgtataaagatatcattctcaattgatacggaattatttttcttacaaaaaggaattg |
75 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6750804 |
ttgtataaagatatcattctcaattgataaggaattatttttcttacaaaaaggaattg |
6750746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University