View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16893_high_24 (Length: 307)
Name: NF16893_high_24
Description: NF16893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16893_high_24 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 11 - 307
Target Start/End: Complemental strand, 55424818 - 55424522
Alignment:
| Q |
11 |
tagctgttgcgttcttttttctcacattctttttcatgttccccattgcaatagtacaaggtcttgcaagtcttgatggaatccataaagcagcaccatg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
55424818 |
tagctgttgcgttcttttttctcacattctttttcatgatccccattgcaatagtacaaggtcttgcaagtcttgatggaatccagaaagcagcaccatg |
55424719 |
T |
|
| Q |
111 |
gttgaatccccttgttagtgagtaagtctaatctcaaagttggatctctggagttatgattctatccgcattcatcacttgattttatttatttgaattt |
210 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55424718 |
gttgaatccccttgttcgtgtgtaagtctaatctcaaagttggatctctggagttatgattctatccgcattcatcacttgattttatttatttgaattt |
55424619 |
T |
|
| Q |
211 |
actttattgtgcagccctgttgttaagtcattcattcaaggttttctacccggtattgtattgaagctttttcttatctttctgccaacaatattga |
307 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55424618 |
actttattgtgcagccctgttgttatgtcattcattcaaggttttctacccggtattgtattgaagctttttcttatctttctgccaacaatattga |
55424522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University