View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16893_high_8 (Length: 386)

Name: NF16893_high_8
Description: NF16893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16893_high_8
NF16893_high_8
[»] chr5 (1 HSPs)
chr5 (76-119)||(6371174-6371217)
[»] chr7 (1 HSPs)
chr7 (76-119)||(33222143-33222186)
[»] chr2 (1 HSPs)
chr2 (332-364)||(20248673-20248705)


Alignment Details
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 76 - 119
Target Start/End: Original strand, 6371174 - 6371217
Alignment:
76 gaagatgatgatccacaaacggtgaagacagggttgagacagtg 119  Q
    |||||||||||||||||||||||||||||| |||||||||||||    
6371174 gaagatgatgatccacaaacggtgaagacaaggttgagacagtg 6371217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 76 - 119
Target Start/End: Original strand, 33222143 - 33222186
Alignment:
76 gaagatgatgatccacaaacggtgaagacagggttgagacagtg 119  Q
    ||||||||||||| |||||||||||||||| |||||| ||||||    
33222143 gaagatgatgatcaacaaacggtgaagacaaggttgatacagtg 33222186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 332 - 364
Target Start/End: Original strand, 20248673 - 20248705
Alignment:
332 gtctaccttttcttctggatacaccatccttct 364  Q
    |||||||||||| ||||||||||||||||||||    
20248673 gtctaccttttcctctggatacaccatccttct 20248705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University