View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16894_high_3 (Length: 438)
Name: NF16894_high_3
Description: NF16894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16894_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 200 - 413
Target Start/End: Complemental strand, 32494388 - 32494175
Alignment:
| Q |
200 |
cacgagcaaatccaacttggcctctttatggctagaactaatttttaagttttaacttatataaatagacctaacaagatcatgaatttgccattttttg |
299 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32494388 |
cacgagtaaatccaacttggcctctttatggctagaactaatttttaagttttaacttatataaatagacctaacaagatcatgaatttgccattttttg |
32494289 |
T |
|
| Q |
300 |
attgccttattggttttgcaggcagttgtgacagaggaggatgggatggagtcaatagctcatagatttctttctgctgctgtcaaggtacaattccacc |
399 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32494288 |
attgccttattggttttgcaggcaattgtgacagaggaggatgggatggagtcaatagctcatagatttctttctgctgctgtcaaggtacaattccacc |
32494189 |
T |
|
| Q |
400 |
tgtatattgcatgt |
413 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32494188 |
tgtatattgcatgt |
32494175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 2 - 138
Target Start/End: Complemental strand, 32494576 - 32494450
Alignment:
| Q |
2 |
atggccaattataatataattaatttacgtagtttgttgagtgtgggttataatgtctactatagtttgagttattgtcggttattgtcagtatattttg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32494576 |
atggccaattataatataattaatttacgtagtttgctgagtgctggttataatgtctactatagtttgagttat----------tgtcagtatattttg |
32494487 |
T |
|
| Q |
102 |
gaagaatgctgttagcatactcgcataaagaaaaatg |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32494486 |
gaagaatgctgttagcatactcgcataaagaaaaatg |
32494450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University