View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16897_high_12 (Length: 345)
Name: NF16897_high_12
Description: NF16897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16897_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 93 - 173
Target Start/End: Complemental strand, 41872230 - 41872152
Alignment:
| Q |
93 |
taataagcaattcttaccccgtctgtgtatgaggaattagcggtctgcagatgcgctttcgggagcagatagagtgtaagg |
173 |
Q |
| |
|
|||||||||||| |||||| || ||||||||||||||| || ||| || |||||||||||||| ||||| |||||||||| |
|
|
| T |
41872230 |
taataagcaattattaccctgt--gtgtatgaggaattaacgatctacaaatgcgctttcgggatcagatggagtgtaagg |
41872152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 28 - 91
Target Start/End: Complemental strand, 41872395 - 41872328
Alignment:
| Q |
28 |
gagttatattatccgctgctcttggagttgagg----tatttctttcgctattgaatctcgtctgtct |
91 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| ||||| |||||||||||||||||||| |||| |
|
|
| T |
41872395 |
gagttatattatctgctactcttggagttgaggtatatatttgtttcgctattgaatctcgtcagtct |
41872328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 44 - 82
Target Start/End: Original strand, 50183095 - 50183133
Alignment:
| Q |
44 |
tgctcttggagttgaggtatttctttcgctattgaatct |
82 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
50183095 |
tgctcttggagttgaggtatttctttcgttattgaatct |
50183133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University