View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16897_high_18 (Length: 329)
Name: NF16897_high_18
Description: NF16897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16897_high_18 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 22 - 329
Target Start/End: Original strand, 38079759 - 38080066
Alignment:
| Q |
22 |
catcatcatgttgaagtcgttagagatcttcctcttccgaatgaaatccaagtttgtgacaacctctcccttgatttgatgagaaggttgctgaactgga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38079759 |
catcatcatgttgaagtcgttagagatcttcctcttccgaatgaaatccaagtttgtgacaacctctcccttgatttgatgagaaggttgctgaactgga |
38079858 |
T |
 |
| Q |
122 |
aagcttcccctcattctatccatcccaagattggatggatgaagattctcgggttttcggtcctccacatcaaagtttgactcgccgtcagccccatcaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38079859 |
aagcttcccctcattctatccatcccaagattggatggatgaagattctcgggttttcggtcctccacatcaaagtttgactcgccgtcagccccatcaa |
38079958 |
T |
 |
| Q |
222 |
catcatactcactgcaatcgttgatgaccatagaaccagtacctccaccagaggataacggggggcaataatctggaaaaagttctcgagccaaggattc |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38079959 |
catcatactcactgcaatcgttgatgaccatagaaccagtacctccaccagaggataacggggggcaataatctggaaaaagttctcgagccaaggattc |
38080058 |
T |
 |
| Q |
322 |
ctcttgat |
329 |
Q |
| |
|
|||||||| |
|
|
| T |
38080059 |
ctcttgat |
38080066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University