View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16897_high_4 (Length: 389)
Name: NF16897_high_4
Description: NF16897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16897_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 24 - 307
Target Start/End: Complemental strand, 48763983 - 48763700
Alignment:
| Q |
24 |
tcatcaaatgatcggtggtagccaagtttaaatcactgaaataatactccacctaaaaaatcccaaccaaaaccctagtcaagttgtagagatgcaattt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48763983 |
tcatcaaatgatcggtggtagccaagtttaaatcgctgaaataatactccacctaaaaaatcccaaccaaaaccctagtcaagttgtagagatgcaattt |
48763884 |
T |
 |
| Q |
124 |
agagagatatgatcaacacgaatagatacataacaatataataatatgaatgaacaattggaacatggaatgaagatgaaattaggcaagttggttgacc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48763883 |
agagagatatgatcaacacgaatagatacataacaatataataatatgaatgaacaattggaacatggaatgaagatgaaattaggcaagttggttgacc |
48763784 |
T |
 |
| Q |
224 |
tgtttcaaaattttgtgatgaggttgttcatcggaatgaggtttggttttggaagaagaagtatgctctggctgctcaacttct |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48763783 |
tgtttcaaaattttgtgatgaggttgttcatcggaatgaggtttggttttggaagaagaagtatgctctggctgctcaacttct |
48763700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University