View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16898_low_3 (Length: 326)
Name: NF16898_low_3
Description: NF16898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16898_low_3 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 1 - 326
Target Start/End: Complemental strand, 15067891 - 15067566
Alignment:
| Q |
1 |
gccgtagaaccacgttcgacttacgaatgggtcagtcaccttcgctcccaaacccaatcctcctccaccttccacccggccatctccacatacaccaaca |
100 |
Q |
| |
|
|||| ||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15067891 |
gccgcagaaccacgtttaccttccgaatgggtcagtcaccttcgctcccaaacccaatcctcctccaccttccaccaggccatctccacatacaccaaca |
15067792 |
T |
 |
| Q |
101 |
tggtcaccgccggcgtccctcctgacaattttgctttccccgccgtcctcaaagcaaccgccggcatccaagaccttaacctcggcaaacaactccatgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15067791 |
tggtcaccgccggcgtccctcctgacaatttcgctttccccgccgtcctcaaagcaaccgccggcatccaagaccttaacctcggcaaacaactccatgc |
15067692 |
T |
 |
| Q |
201 |
ccatgtcttcaaattcggacaagctctccctactgctgtccctaactccctcgttaacatgtacggtaaatgcggtgatatcgacgctgcacgccgtgtg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15067691 |
ccatgtcttcaaattcggacaagctctccctactgctgtccctaactccttcgttaacatgtacggtaaatgcggtgatatcgacgctgcacgccgtgtg |
15067592 |
T |
 |
| Q |
301 |
tttgatgaaataaccaaccgtgatga |
326 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
15067591 |
tttgatgaaataaccaaccgtgatga |
15067566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University