View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1689_low_18 (Length: 222)
Name: NF1689_low_18
Description: NF1689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1689_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 16 - 206
Target Start/End: Complemental strand, 11051282 - 11051093
Alignment:
| Q |
16 |
aaaatattaggttgagtcgcaaactaaatcactctcttttaaacattttgcagatttgtctcaatggtgctcggaatttcttctatttgttatacatttg |
115 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| | ||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11051282 |
aaaatattaggttgagtcgcgaactaaatcaccat-ttttaaacattttgcggatttgtctcaatggtgctcgtaatttcttctatttgttatacatttg |
11051184 |
T |
 |
| Q |
116 |
aaaattattccttttctttatgagttatactcttaaatttggtccccgcaaaccttattttctaacttcgtccctgctaacacctactatt |
206 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
11051183 |
aaaattattctttttctttatgagttatactcttaaatttggtccccacaaaccttatcttcttacttcgtccctgctaacacctactatt |
11051093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University