View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1690-Insertion-1 (Length: 295)
Name: NF1690-Insertion-1
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1690-Insertion-1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 7 - 291
Target Start/End: Complemental strand, 36529610 - 36529326
Alignment:
| Q |
7 |
agatggcaaagtacgttggtcaggtggaagagcaacatggcgaatcgtaagtggaaataaaaacgagggtcacaatcctatcataaactattctggcaat |
106 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| || |||||||||| ||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
36529610 |
agatggcaaagtacgttggtcaggcggaagagcaacatggcgaagcggaagtggaaatcaaaacgagggtcacaattctatcataaactattctgacaat |
36529511 |
T |
|
| Q |
107 |
ggaaaagcgggcaacaatgaaaatcagagtagcagtggaagcggggatagcggtgaaaatagaaatttgggatgcatgtcaaacgtacatggtgaaaaac |
206 |
Q |
| |
|
||||||||||||||||||||||||||| | ||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36529510 |
ggaaaagcgggcaacaatgaaaatcagggcagcggtggaagcggggatagcggtggaaatagaaatttgggatgcatgtcaaacgtacatggtgaaaaac |
36529411 |
T |
|
| Q |
207 |
tataagaaaatgctgtgtgttcttaaaatagcctaaaaatgcatcatcaccttttacatgaagttgttgtttggaatgattatta |
291 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36529410 |
tataacaaaatgctgtgtgttcttaaaatagcctaaaaatgcatcatcaccttttacatgaagatgttgtttggaatgattatta |
36529326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University