View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1690-Insertion-10 (Length: 242)
Name: NF1690-Insertion-10
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1690-Insertion-10 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 11 - 242
Target Start/End: Complemental strand, 21614367 - 21614136
Alignment:
| Q |
11 |
ttagcgtcggaaagtgattgccagagatgaagaagcttcgacattactccggccacttcgaaggctaaaacggcgatgcgttttgggtttgggtttgaag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21614367 |
ttagcgtcggaaagtgattgccagagatgaagaagcttcgacattactccggcgacttcgaaggctaaaacggcgatgcgttttgggtttgggtttgaag |
21614268 |
T |
|
| Q |
111 |
acggcgtcgttttgggttgaattgagttgaaagtggttgaaaatgctgttttgaatcttgtgagtaaagtttccaagaccattgaaaaaagtgannnnnn |
210 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |||| |
|
|
| T |
21614267 |
acggtgtcgttttgggttgaattgagttgaaagtggttgaaaatgctgttttgaatcttgtgagtaaagtttctaaggccattgaaaaaggtgatttttt |
21614168 |
T |
|
| Q |
211 |
nagtagagatgaagagaagagtggatttggtg |
242 |
Q |
| |
|
||| ||||||||||||||||||||||||||| |
|
|
| T |
21614167 |
tagtggagatgaagagaagagtggatttggtg |
21614136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University