View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1690-Insertion-11 (Length: 169)
Name: NF1690-Insertion-11
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1690-Insertion-11 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 7 - 169
Target Start/End: Original strand, 43895967 - 43896126
Alignment:
| Q |
7 |
attaattatatttgtagacatctactaatatatctggaggcatatggttttataaatnnnnnnnntaaaatctggaggcatggtaaaaacttgtaaaaat |
106 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43895967 |
attaattatatttgtagatatctactaatatatctggaggcatatggttttataaataagaaa---aaaatctggaggcatggtaaaaacttgtaaaaat |
43896063 |
T |
|
| Q |
107 |
tgactaatatcaccgacgcttggtagattgatttggcttaatcggtaagtatgtatatcgcta |
169 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43896064 |
tgactaatatcaccgacgcttgggagattgatttggctagatcggtaagtatgtatatcgcta |
43896126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University