View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1690-Insertion-4 (Length: 157)
Name: NF1690-Insertion-4
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1690-Insertion-4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 4e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 4e-58
Query Start/End: Original strand, 8 - 149
Target Start/End: Original strand, 27495940 - 27496081
Alignment:
| Q |
8 |
attgtcttggagatggagtcttactaggttggagttgtgtccgtgtttatattttgaatggtgttggaatcccattggcgtcgttatgggctttgggctg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27495940 |
attgtcttggagatggagtcttactaggttgaagttgtgtccatgtttatattttgaatggcgttggaatcccattggcgtcgttaggggctttgggctg |
27496039 |
T |
|
| Q |
108 |
ctgtttgttatcgacagtagggctcccattattgctgctctt |
149 |
Q |
| |
|
|||||||||||||| | ||||||||||||| ||||||||||| |
|
|
| T |
27496040 |
ctgtttgttatcgatattagggctcccattgttgctgctctt |
27496081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University