View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1690-Insertion-7 (Length: 186)
Name: NF1690-Insertion-7
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1690-Insertion-7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 7 - 176
Target Start/End: Complemental strand, 8566854 - 8566685
Alignment:
| Q |
7 |
actttgaaacaccacaataaaagaaaataaagagatcatggatagttcattctggtggggcttctaacacatacattgcatgtattccatccaagtgaga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| ||| |||||| || |
|
|
| T |
8566854 |
actttgaaacaccacaataaaagaaaataaagagatcatggatagttcatcctggtggggcttctaacacatatattgcatgtatttcatacaagtggga |
8566755 |
T |
 |
| Q |
107 |
cttataattcacacttgacatataacaactcatcatatgtaaattcttccattcatctcgatatgctccc |
176 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
8566754 |
cttataactcacacttgacatataacaactcatcatatgtaaattcctccattcatctcggtatgctccc |
8566685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University