View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1690-Insertion-8 (Length: 201)
Name: NF1690-Insertion-8
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1690-Insertion-8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 27 - 201
Target Start/End: Complemental strand, 1792558 - 1792384
Alignment:
| Q |
27 |
gtgtgattcaatgatatctttatcattttcgtacttaagtgttatgcaaatttgtataagcttccatgccttttttgcaaagtttcatgccttatgggaa |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1792558 |
gtgtgattcaatgatatctttatcattttcgtacttaagtgttatgcaaatttgtataagcttccatgccttttttgcaaagtttcatgccttatgggaa |
1792459 |
T |
 |
| Q |
127 |
ttgtgagtttttgcataaattatgcaaccnnnnnnngtgttttatttcaggtcaatttggggaagtgcttttcaa |
201 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1792458 |
ttgtgagtttttgcataaattatgcaacctttttttgtgttttatttcaggtcaatttagggaagtgcttttcaa |
1792384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University