View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16900_low_2 (Length: 265)
Name: NF16900_low_2
Description: NF16900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16900_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 10078817 - 10079074
Alignment:
| Q |
1 |
ccatccccaggttcatgcagtacagtgccacaggcacaaccaaactcgtccccttttcattcaccaacaccgtcctcatctaacaacaacccacaaactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10078817 |
ccatccccaggttcatgcagtacagtgccacaggcacaaccaaactcgtccccttttcattcaccaacaccgtcctcatctaacaacaacccgcaaactt |
10078916 |
T |
|
| Q |
101 |
ctcaccctggcttaacatctgcaaatcacatgggtacagtaaactcaccagctaatatttccatgcaacaacagcaggcatctgtttctggtgaagccga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
10078917 |
ctcaccctggcttaacatctgcaaatcacatgggtacagtaaactcaccagctaatatttccatgcaacaacagcaggcatctgtttctggtgaagctga |
10079016 |
T |
|
| Q |
201 |
ccctagtaatgatgctcagaactcggtccagaaaataattcacgacatgatgatgtcc |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10079017 |
ccctagtaatgatgctcagaactcggtccagaaaataattcacgacatgatgatgtcc |
10079074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 40776105 - 40776005
Alignment:
| Q |
1 |
ccatccccaggttcatgcagtacagtgccacaggcacaaccaaactcgtccccttttcattcacca---acaccgtcctcatctaacaacaacccacaaa |
97 |
Q |
| |
|
|||||||| ||||| | |||||| ||||||||||| || |||||||| ||||||||||| |||||| ||||| ||||||||||| ||| |||||||| |
|
|
| T |
40776105 |
ccatcccctggttcctccagtactgtgccacaggcccagccaaactcatccccttttcagtcaccacctacaccatcctcatctaataaccccccacaaa |
40776006 |
T |
|
| Q |
98 |
c |
98 |
Q |
| |
|
| |
|
|
| T |
40776005 |
c |
40776005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University