View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16902_high_15 (Length: 250)
Name: NF16902_high_15
Description: NF16902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16902_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 148
Target Start/End: Original strand, 40543733 - 40543880
Alignment:
| Q |
1 |
caccagcaaatgttttcgcaaagagagttccaccaaagccaccatggattgtcgacagatttgagccctcaagggtgattggttcaaatttggttaacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
40543733 |
caccagcaaatgttttcgcaaagagagttccaccaaagccaccatggattgtcgacagatttgagccctcaagggtgaatgtttcaaatttggttaacta |
40543832 |
T |
 |
| Q |
101 |
tgtttcttatgatgtttccttctttttcatgttctacttgtgttgttg |
148 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40543833 |
tgtttcttatgatgtttccttgtttttcatgttctacttgtgttgttg |
40543880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University