View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16902_high_17 (Length: 220)
Name: NF16902_high_17
Description: NF16902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16902_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 18 - 158
Target Start/End: Complemental strand, 11196626 - 11196486
Alignment:
| Q |
18 |
aaaaggaggtcaggaggaacagataaaccagctttgagatacttgaagatgagagcttgatgttctagctcttgccattgagagacagtgaacggtggat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11196626 |
aaaaggaggtcaggaggaacagataaaccagctttgagatacttgaagatgagagcttgatgttctagctcttgccattgagagacagtgaacggtggat |
11196527 |
T |
 |
| Q |
118 |
gtgttggagaccacatcaacggcggttgttgaatgctcatg |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11196526 |
gtgttggagaccacatcaacggcggttgttgaatgctcatg |
11196486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 179 - 213
Target Start/End: Complemental strand, 11196465 - 11196431
Alignment:
| Q |
179 |
aaggtgatgatgttgcgaggaagattatgatgatg |
213 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11196465 |
aaggtgatgatgttgtgaggaagattatgatgatg |
11196431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University