View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16902_high_5 (Length: 435)
Name: NF16902_high_5
Description: NF16902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16902_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 4e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 262 - 385
Target Start/End: Complemental strand, 29223736 - 29223613
Alignment:
| Q |
262 |
atttagaattgacatctaaaacgccactgaagtagtctaatgacaagtggacacattgttgtggctaaacacgggccatctaagataatttgaatagtaa |
361 |
Q |
| |
|
|||||||||||||||| ||||||||||| | ||||| |||||||||||||| ||||| ||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
29223736 |
atttagaattgacatccaaaacgccactcaggtagtgtaatgacaagtggatacatttttgtggctaaacacgggacatctaagataatttgaatattaa |
29223637 |
T |
|
| Q |
362 |
tatttggaaaatgttattttcagc |
385 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
29223636 |
tatttggaaaatgttatttccagc |
29223613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 16 - 95
Target Start/End: Complemental strand, 29223830 - 29223747
Alignment:
| Q |
16 |
ctcggtaagattatttgctgaattatgcttagct----tcaaaatgaatttaattatttggttaaattttgaaaactttatttg |
95 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29223830 |
ctcggtaagatcatttgctgaattatgcttagctagcttcaaaatgaatttaattatttggttaaattttgaaaactttatttg |
29223747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 367 - 430
Target Start/End: Original strand, 1561253 - 1561316
Alignment:
| Q |
367 |
ggaaaatgttattttcagcgaaggtaatgcatcaagaattttttcaatcacaactgacaagttt |
430 |
Q |
| |
|
|||||||| ||||| ||||||||| |||| |||||||||||||||| |||| ||||||||||| |
|
|
| T |
1561253 |
ggaaaatgctatttccagcgaaggaaatgaatcaagaattttttcagacacagctgacaagttt |
1561316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 367 - 412
Target Start/End: Complemental strand, 11643485 - 11643440
Alignment:
| Q |
367 |
ggaaaatgttattttcagcgaaggtaatgcatcaagaattttttca |
412 |
Q |
| |
|
|||||||||||||| ||| ||||| |||| |||||||||||||||| |
|
|
| T |
11643485 |
ggaaaatgttatttccagtgaaggaaatgtatcaagaattttttca |
11643440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University