View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16902_low_19 (Length: 246)
Name: NF16902_low_19
Description: NF16902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16902_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 37185023 - 37185249
Alignment:
| Q |
1 |
aatatcttgttggaaaagaataaatcacttgtctctggtaaatgatgctttttggagctattattataatggatgnnnnnnngattaatctcaagtctta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37185023 |
aatatcttgttggaaaagaataaatcacttgtctctggtaaatgatgctttttggagctattattataatggatgtttttttgattaatctcaagtctta |
37185122 |
T |
 |
| Q |
101 |
actgaaatttataaaccatacaagttcaactaaattatagccnnnnnnnaacgaaattggaaatataatcttcaatgggggaaaaccgtacatatataat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37185123 |
actgaaatttataaaccatacaagttcaactaaattatagccattttttaacgaaattggaaatataatcttcaatgggggaaaaccgtacatatatgat |
37185222 |
T |
 |
| Q |
201 |
cggaacataaaaaacatatatgatcgg |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
37185223 |
cggaacataaaaaacatatatgatcgg |
37185249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University