View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16903_high_5 (Length: 373)
Name: NF16903_high_5
Description: NF16903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16903_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 364; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 1 - 368
Target Start/End: Complemental strand, 8188462 - 8188095
Alignment:
| Q |
1 |
ctgtccagcaactcctgaagctctaactcaaagtctgcatcattatcctcatcatcatcaaggttttcattttcatgagatgaaagaccgtcacgttctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8188462 |
ctgtccagcaactcctgaagctctaactcaaagtctgcatcattatcctcatcatcatcaaggttttcattttcatgagatgaaagaccgtcacgttctc |
8188363 |
T |
 |
| Q |
101 |
caccctgtaatacagctgctagaaattttttatactcttcttcatcatcgacattttgaacatcatcttcatcatcggtctcttgaagaaaggtctcaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8188362 |
caccctgtaatacagctgctagaaattttttatactcttcttcatcatcgacattttgaacatcatcttcatcatcagtctcttgaagaaaggtctcaag |
8188263 |
T |
 |
| Q |
201 |
ctcatcaagactgaaaccttcaagcgaataacgagctctagtacgcatacaaatagcatcctcagtatctatgtctatcactgggcttcggggtttcgtt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8188262 |
ctcatcaagactgaaaccttcaagcgaataacgagctctagtacgcatacaaatagcatcctcagtatctatgtctatcactgggcttcggggtttcgtt |
8188163 |
T |
 |
| Q |
301 |
gtgttgcttatgtcttctatcctaaaaccatcactagtaccactaatcaagtcattcttcttctcctt |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8188162 |
gtgttgcttatgtcttctatcctaaaaccatcactagtaccactaatcaagtcattcttcttctcctt |
8188095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University