View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16904_high_17 (Length: 505)
Name: NF16904_high_17
Description: NF16904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16904_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 366; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 16 - 497
Target Start/End: Original strand, 297893 - 298365
Alignment:
| Q |
16 |
tctctaacaacaacactgctgctcatgtcactgccaacaacaaccttcgcaatcgcaggcactagcatatataattagcatgaggactaataataagtaa |
115 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
297893 |
tctctaaaaacaacactgctgctcatgtcactgccaacaacaaccttcgcaatcgcaggcactagcatatataattatcatgaggactaataataagtaa |
297992 |
T |
 |
| Q |
116 |
aaatcaattcattgtttcattcattatggtggtgggtgactatcatatttaactgtatattctatatgtataattcnnnnnnncttgccaagttgcttga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
297993 |
aaatcaattcattgtttcattcattatggtggtgggtgactatcatatttaactgtatattctatatgtataattctttttttcttgcccagttgcttga |
298092 |
T |
 |
| Q |
216 |
ggatcatttaatcaatacaagtcttttaagggatttgaatagaaaaaatatttttagtgataacaaaacttttctcaaaatatttgattttgatttcttg |
315 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
298093 |
ggatcatttaatcaata----tc-tttaagggatttgaatagaaaaaatatttttagtgataacaaaacttttctcaaaatatttgattttgatttcttg |
298187 |
T |
 |
| Q |
316 |
gttccagaagttctccatggtgattgcaactctatagtgattcctttatttatttannnnnnncaatctgatttacttctagtaccggtattattgtaca |
415 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| | ||||||||||||||| |||||||||| |
|
|
| T |
298188 |
gttccagaagttctccatggtgattgcaactctatagtgattcctttttttatttatttttttcaatc----tcacttctagtaccggtcttattgtaca |
298283 |
T |
 |
| Q |
416 |
ctctgttattgatggttagtgaagatgatattgatgagattgtgttcagaaacatgtcattatgactacttatgttcatctc |
497 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
298284 |
ctctgttattgatagttagtgaagatgatattgatgagattgtgttcagaaacatgtcattatgactacttatgttcttctc |
298365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University