View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16904_high_46 (Length: 348)
Name: NF16904_high_46
Description: NF16904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16904_high_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 23 - 224
Target Start/End: Original strand, 33734644 - 33734848
Alignment:
| Q |
23 |
aaatgttcgacctttatgaaaaccacataattatgacatttatt---acatagttccacgaagtaccttcacaaacataaattctttagatagactatta |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
33734644 |
aaatgttcgacctttatgaaaaccacataattatgacatttgttctgacatagttccacgaagtaccttcacaaacataaattctttagattgactacta |
33734743 |
T |
 |
| Q |
120 |
gactaatcttcccttaagtgcttaagtcgcaacttaacagtcttttgtctctctccaatattgtgttatgctcaaactaaacaatgtgcccacccacaag |
219 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||| ||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33734744 |
gactaatcttcccttgagtgcttaagtcgcaagttaacactcttttgtccctctccaatattttgttatgctcaaactaaacaatgtgcccacccacaag |
33734843 |
T |
 |
| Q |
220 |
ttcaa |
224 |
Q |
| |
|
||||| |
|
|
| T |
33734844 |
ttcaa |
33734848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University