View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16904_high_63 (Length: 283)
Name: NF16904_high_63
Description: NF16904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16904_high_63 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 9 - 185
Target Start/End: Complemental strand, 9404453 - 9404277
Alignment:
| Q |
9 |
gaaatgaaaatagcagttggaaacggacacgtcataataagtgcaatcaagagcaattgcaataatgtgaaataaagtatgatttgattttgagaaaagt |
108 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9404453 |
gaaatgacaatagcagttggaaacggacacgtcataataagtgaaatcaagagcaattgcaataatgtgaaataaaatatgatttgattttgagaaaagt |
9404354 |
T |
 |
| Q |
109 |
agaagaaaataggaaacaaaccgatcctttgtgttcgacgtgtttagtttgggagaatcctttgcgaataacctgat |
185 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9404353 |
agaagaaaatgggaaacagaccgatcctttgtgttcgacgtgtttagtttgggagaatcctttgcgaataacctgat |
9404277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University