View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16904_high_7 (Length: 611)
Name: NF16904_high_7
Description: NF16904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16904_high_7 |
 |  |
|
| [»] scaffold0229 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 51; Significance: 6e-20; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 350 - 412
Target Start/End: Complemental strand, 28666348 - 28666286
Alignment:
| Q |
350 |
tactactaggtgcttttacaaagaaataattcctttggagagatagtataatgaatagagagt |
412 |
Q |
| |
|
||||||| |||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28666348 |
tactacttggtgctcttacaaagatataattcctttggagagatagtataatgaatagagagt |
28666286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 181 - 274
Target Start/End: Complemental strand, 28667260 - 28667167
Alignment:
| Q |
181 |
catggtcgtagactaaatatat-cacctctcatagctaagatcgaacatttgtttgtcatttatgctagcatctgtaaaattgaatcatagaatt |
274 |
Q |
| |
|
|||||||||| ||||||| || ||||||||||||||||||||||||||||||||||| |||| ||||||||| ||||||| |||||||||||| |
|
|
| T |
28667260 |
catggtcgtacactaaatgcatacacctctcatagctaagatcgaacatttgtttgtctttta-gctagcatccttaaaattaaatcatagaatt |
28667167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 73 - 137
Target Start/End: Complemental strand, 28667350 - 28667286
Alignment:
| Q |
73 |
tttagatctaacatttgttcgttcgttatattatgagagattggtctctttcgctagactatatg |
137 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||| |||| || |||||| |||||||| ||||| |
|
|
| T |
28667350 |
tttagatcgaacatttgttcgttcgttatgctatgggagactgatctcttccgctagaccatatg |
28667286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 566 - 600
Target Start/End: Complemental strand, 9023707 - 9023673
Alignment:
| Q |
566 |
tttagctcattgttttgtttttattagctcttcat |
600 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
9023707 |
tttagctcattgttgtgtttttattagctcttcat |
9023673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000009; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 522 - 600
Target Start/End: Original strand, 13758365 - 13758443
Alignment:
| Q |
522 |
ataatatgagaaaaatgatctttatataatacatcatnnnnnnntttagctcattgttttgtttttattagctcttcat |
600 |
Q |
| |
|
||||||||||||||||| | ||| |||||||||||| |||||||||||||| ||||||||||| |||||||| |
|
|
| T |
13758365 |
ataatatgagaaaaatgccccttacataatacatcataattttttttagctcattgttgtgtttttattaactcttcat |
13758443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 566 - 600
Target Start/End: Complemental strand, 1213272 - 1213238
Alignment:
| Q |
566 |
tttagctcattgttttgtttttattagctcttcat |
600 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
1213272 |
tttagctcattgttgtgtttttattagctcttcat |
1213238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0229 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0229
Description:
Target: scaffold0229; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 566 - 600
Target Start/End: Complemental strand, 14435 - 14401
Alignment:
| Q |
566 |
tttagctcattgttttgtttttattagctcttcat |
600 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
14435 |
tttagctcattgttgtgtttttattagctcttcat |
14401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 492 - 600
Target Start/End: Complemental strand, 9421033 - 9420925
Alignment:
| Q |
492 |
gaccgttcctagagtttcatggacttagatataatatgagaaaaatgatct-ttatataatacatcatnnnnnnntttagctcattgttttgtttttatt |
590 |
Q |
| |
|
||||||||||||||||| ||| ||||| |||||||| || |||||| ||| |||||||||| ||||| ||||| | |||||| |||||||||| |
|
|
| T |
9421033 |
gaccgttcctagagtttactggccttaggtataatattag-aaaatggtctcttatataatagatcataattttttttagtttattgttgtgtttttatt |
9420935 |
T |
 |
| Q |
591 |
agctcttcat |
600 |
Q |
| |
|
|| ||||||| |
|
|
| T |
9420934 |
agatcttcat |
9420925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University