View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16904_high_73 (Length: 255)
Name: NF16904_high_73
Description: NF16904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16904_high_73 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 90 - 238
Target Start/End: Complemental strand, 11859437 - 11859292
Alignment:
| Q |
90 |
taactctttattcttcttactctttctccgccgtatcaaaaggattttcataccnnnnnnngcattattattttttcctttctctttcacttgattctct |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11859437 |
taactctttattcttcttactctttctccgccgtatcaaaaggattttcataccaaaaaaagcattatt---ttttcctttctctttcacttgattctct |
11859341 |
T |
 |
| Q |
190 |
cttaaaaaatattcccttttttagcagaatcattgtcactcacaaccct |
238 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
11859340 |
cttcaaaaatattcccttttttagcagaatcattgtcattcataaccct |
11859292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University