View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16904_high_74 (Length: 254)
Name: NF16904_high_74
Description: NF16904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16904_high_74 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 11 - 234
Target Start/End: Original strand, 34611592 - 34611830
Alignment:
| Q |
11 |
gaatcataggtgggttggtaatgttctgaagtgaaacagattggttgtggtttactgtgcaagtgcagcgcgggatgctgcaaaaaagtattggaaatat |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34611592 |
gaattataggtgggttggtaatgttctgaagtgaaacagattggttgtggtttactg--caagtgcagcgcgggatgctgcaaaaaagtattggaaatat |
34611689 |
T |
|
| Q |
111 |
atcagtt-----------------agttttatgctgatgtgcttatgttaggtgactctgagttaagtctatttgagtgtaattggtgaatactttgatg |
193 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34611690 |
atcagttgttccaaattctggtttagttttatgctgatgtgcttatgttaggtgactctgagttaagtctatttgagtgtaattggtgaatactttgatg |
34611789 |
T |
|
| Q |
194 |
ttactttatctgttgttttgatctatctttgcatacaacct |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34611790 |
ttactttatctgttgttttgatctatctttgcatacaacct |
34611830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University